View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12456_high_4 (Length: 278)
Name: NF12456_high_4
Description: NF12456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12456_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 24 - 267
Target Start/End: Original strand, 36062604 - 36062847
Alignment:
| Q |
24 |
tcccctttggcagccatgggcaatagtaacatgagagccatggctataagactcaataacttgaaagaacccatttgttaatgacacaaatagtagagaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36062604 |
tcccctttggcagccatgggcaatagtaacatgagaaccatggctataagactcaacagcttgaaagaacccatttgttaatgacacaaatagtagagaa |
36062703 |
T |
|
| Q |
124 |
ttggaaagtaaggagaagaaggagtatctataacaataagaattagtacagggtgtatgattgaaaagggatttgaacgtgtccttctatatatagtaaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36062704 |
ttggaaagtaaggagaagaaggagtatctataacaataagaattagtacagggtgtatgattgaaaagggatttgaacgtgtccttctatatatagtaaa |
36062803 |
T |
|
| Q |
224 |
gagggtgttttttgtgacgtgtttttattgttggttcacaggtt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36062804 |
gagggtgttttttgtgacgtgtttttattgttggttcataggtt |
36062847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University