View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12459_high_13 (Length: 234)
Name: NF12459_high_13
Description: NF12459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12459_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 9 - 216
Target Start/End: Original strand, 25952294 - 25952501
Alignment:
| Q |
9 |
agaagcagagagaaggggaagctaaataatcttgcaatgtttcaaatcatctgttatagctaaggtctttagaaagagtgaaacatattaattatttatg |
108 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25952294 |
agaagcagaaacaaggggaagctaaataatctggcaatgtttcaaatcatctgttatagctagggtctttagaaagagtgaaacatattaattatttatg |
25952393 |
T |
 |
| Q |
109 |
ttgatcttataagtggaagtagattttgaaattaacattgaatttgaatagcttaacttgtaatcatttttaatatttgcttcgctatcgaattattctt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25952394 |
ttgatcttataagtggaagtagattttgaaattaacattgaatttgaatagcttcacttataatcattttttatatttgcttcgctatcgaattattctt |
25952493 |
T |
 |
| Q |
209 |
ttagagat |
216 |
Q |
| |
|
|||||||| |
|
|
| T |
25952494 |
ttagagat |
25952501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University