View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12459_high_7 (Length: 360)
Name: NF12459_high_7
Description: NF12459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12459_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 19 - 346
Target Start/End: Original strand, 10858863 - 10859190
Alignment:
| Q |
19 |
ttcccagcctcagtagccaaagatcttgtgaaacttgaagatctacacgtgaaacactgtgaagagctgatggttattgttgcagagaataatgcatatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10858863 |
ttcccagcctcagtagccaaagatcttgtgaaacttgaagatctacacgtgaaacactgtgaagagctgatggttattgttgcagagaataatgcatatc |
10858962 |
T |
 |
| Q |
119 |
ccaaaggaacaattttggagagttttgcatctcatgaaggtgatgcatcggatgaggttgaaaagataatatttgaggagctccaggctttgtatcttaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10858963 |
ccaaaggaacaattttggagagttttgcatctcatgaagttgatgcatcggatgaggttgaaaagataatatttgaggagctccaggctttgtatcttaa |
10859062 |
T |
 |
| Q |
219 |
agatttacatgaactcaagtgcttttattcagggaattttactctgtgttttccatccttggagcacgtgtttgtaatcaactgtcacaagatggaaact |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10859063 |
agatttacatgaactcaagtgcttttattcagggaattttactctgtgttttccatccttggagcacgtgtttgtaatcaactgtcacaaaatggaaact |
10859162 |
T |
 |
| Q |
319 |
ttctgtccaggtaccatcaatgcacaca |
346 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10859163 |
ttctgtccaggtaccatcaatgcacaca |
10859190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University