View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12459_low_10 (Length: 315)

Name: NF12459_low_10
Description: NF12459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12459_low_10
NF12459_low_10
[»] chr3 (1 HSPs)
chr3 (224-310)||(23924962-23925048)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 224 - 310
Target Start/End: Original strand, 23924962 - 23925048
Alignment:
224 tattttctttaccttaaaactggatatgcgcccaaacgtttcttctccctaattacttatattttcatcatcatttatttctgtgct 310  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23924962 tattttctttaccttaaaactggatatgcgaccaaacgtttcttctccctaattacttatattttcatcatcatttatttctgtgct 23925048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University