View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12459_low_12 (Length: 252)
Name: NF12459_low_12
Description: NF12459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12459_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 133 - 241
Target Start/End: Complemental strand, 34848872 - 34848764
Alignment:
| Q |
133 |
tagtcaaaatgttattttgtacatgagtgtccacaaaatatttttcttgtaatttccatcctgtccactttttatctgatggtatgttttgccaagtgtt |
232 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34848872 |
tagtcaaaatgttatttagtacatgagtgtccacaaaatatttttcttgtaattgccatcctgtccactttttatccgatggtatgttttgccaagtgtt |
34848773 |
T |
 |
| Q |
233 |
ctctgcttc |
241 |
Q |
| |
|
||||||||| |
|
|
| T |
34848772 |
ctctgcttc |
34848764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 34848982 - 34848941
Alignment:
| Q |
23 |
atacacctctaattttcttacacctatgcaacactttatttg |
64 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
34848982 |
atacacctctaatttccttacacctatccaacactttatttg |
34848941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University