View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_high_12 (Length: 459)
Name: NF1245_high_12
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 6e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 98 - 214
Target Start/End: Original strand, 24994652 - 24994765
Alignment:
| Q |
98 |
aatacttgctcgacttgcatttctgaagtccttgatggagtaatttatgtatgtctgataaaaatgtttttacaatattttgttggttgttgttttattg |
197 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24994652 |
aatacttgctcgatttgcatttgtgaagtccttgatggagtaatttatgtatgt---ataaaaatgtttttacaatattttgttggttgttgttttattg |
24994748 |
T |
 |
| Q |
198 |
atacttatgtgtatgac |
214 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24994749 |
ctacttatgtgtatgac |
24994765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 359 - 448
Target Start/End: Original strand, 24994909 - 24994998
Alignment:
| Q |
359 |
gtcaattaaaaatatgaaacttannnnnnnatccttgaaaaatatatgtattaa-tttttcatctcactatcgtatcttatttttattcat |
448 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||||||||| |||||| ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
24994909 |
gtcaattaaaaatatgaaaattaattttttattcttgaaaaatatatatattaattttttaatctcactatc-tatcttatttttattcat |
24994998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University