View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1245_high_16 (Length: 431)

Name: NF1245_high_16
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1245_high_16
NF1245_high_16
[»] chr4 (1 HSPs)
chr4 (98-214)||(24994652-24994765)


Alignment Details
Target: chr4 (Bit Score: 91; Significance: 6e-44; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 98 - 214
Target Start/End: Original strand, 24994652 - 24994765
Alignment:
98 aatacttgctcgacttgcatttctgaagtccttgatggagtaatttatgtatgtctgataaaaatgtttttacaatattttgttggttgttgttttattg 197  Q
    ||||||||||||| |||||||| |||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||    
24994652 aatacttgctcgatttgcatttgtgaagtccttgatggagtaatttatgtatgt---ataaaaatgtttttacaatattttgttggttgttgttttattg 24994748  T
198 atacttatgtgtatgac 214  Q
     ||||||||||||||||    
24994749 ctacttatgtgtatgac 24994765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University