View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_high_41 (Length: 274)
Name: NF1245_high_41
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 41 - 246
Target Start/End: Complemental strand, 34630215 - 34630010
Alignment:
| Q |
41 |
atgaggaaataaacttcacgtgtttgcccgcaccatgtgattgtgctgttttgtttagtacacctcaaacctgaacatgtcacacccacaatcatcatgg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34630215 |
atgaggaaataaacttcacgtgtttgcccgcaccatgtgattgtgctgttttgtttagtacacctcaaacctgaacatgtcacacccacaatcatcatgg |
34630116 |
T |
 |
| Q |
141 |
cttttgtattgcctatctataattttcatctaacatatatttcaaagttcatgctagattgaactaaaattcattaagtaattattgtgtatggttttca |
240 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34630115 |
cttttgtattgcctatctataattgacatctaacatatatttcaaagttcatgctagattgaactaaaattcataaagtaattattgtgtatggttttca |
34630016 |
T |
 |
| Q |
241 |
tctcac |
246 |
Q |
| |
|
| |||| |
|
|
| T |
34630015 |
tgtcac |
34630010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University