View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_high_45 (Length: 265)
Name: NF1245_high_45
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_high_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 10002084 - 10001848
Alignment:
| Q |
1 |
ttgaaaaaattgaatgattagtgattaaagtcatacaagttgaacaattaccgtcaaatttaacgaacttatagtgtagaattgtgaaggaataagaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10002084 |
ttgaaaaaattgaatgattagtgattaaagtcatacaagttgaacaattaccgtcaaatttaacgaacttatagtgtagaattgtgaaggaataagaact |
10001985 |
T |
 |
| Q |
101 |
tatcaagccttatttttaactcatctctgtttattttgtattgcacattgtacagtgctttgaattggtggaccatcatgtccaacttttcttctcaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10001984 |
tatcaagccttatttttaactcatctctgtttgttttgtattgcacattgtacagtgctttgaattggtggaccatcatgttcaacttttcttctcaaaa |
10001885 |
T |
 |
| Q |
201 |
atagctcgaatgatgcctgcagaactctgtgaaaagt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10001884 |
atagctcgaatgatgcctgcagaactctgtgaaaagt |
10001848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University