View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_high_54 (Length: 226)
Name: NF1245_high_54
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_high_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 3242183 - 3242413
Alignment:
| Q |
1 |
tataatatctgatacgaaaacatatgttttgctaatagctatggtgttgataattttttaagttggtaaaactatttttcgtcacc-----ttgcatatg |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
3242183 |
tataatatctgatacgaaaacatatgttttgctaatggctatggtgttgataattttttaagttggtaaaactatttttcgtcaccgatgtttgaatatg |
3242282 |
T |
 |
| Q |
96 |
aactttaggtttaaagcttgaaaatttatatgcaagtggatcaaaatgacctaaaaaga-------gatcaaatccttatccgaaattaagtttagtcca |
188 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
3242283 |
aactttaggtttaaagtttgaaaattcatatgcaagcggatcaaaatgacctaaaaagagataaatgatcaaatccttatccgaaattaagttaagtcca |
3242382 |
T |
 |
| Q |
189 |
ctatagtagttttgcatgcgtatattattcg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3242383 |
ctatagtagttttgcatgcgtatattattcg |
3242413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University