View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_low_19 (Length: 452)
Name: NF1245_low_19
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 283 - 423
Target Start/End: Complemental strand, 17657125 - 17656985
Alignment:
| Q |
283 |
tacttttaaatcattatatttatttttgtatttatgattgttaaaaatacatcaatacataataaagataatttcgtaaaagtgtaatttcttttgataa |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17657125 |
tacttttaaatcattatatttatttttgtatttatgattgttaaaaatacatcaatagataataaagataatttcgtaaaagtgtaatttcttttgataa |
17657026 |
T |
 |
| Q |
383 |
tattttattgtattcctaatttgtatgtaaatacttaaaac |
423 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17657025 |
tattttattgtattcctaatttgtatgtaaatacttaaaac |
17656985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University