View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1245_low_38 (Length: 340)

Name: NF1245_low_38
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1245_low_38
NF1245_low_38
[»] chr7 (2 HSPs)
chr7 (244-329)||(7152280-7152365)
chr7 (30-64)||(7152429-7152463)


Alignment Details
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 244 - 329
Target Start/End: Complemental strand, 7152365 - 7152280
Alignment:
244 agacctggtgattctcaagtggatgccgttttgatccaatggtcgaatttgttagcttctaccaatgctttcccatattccttcat 329  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
7152365 agacctggtgattctcaagtggatgccgttttgatccaatggtcgaatttgttagcttctaccaatgctttcccagattccttcat 7152280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 64
Target Start/End: Complemental strand, 7152463 - 7152429
Alignment:
30 tgtttttggtacgggaggaagagaactttactgat 64  Q
    |||||||||||||||||||||||||||||||||||    
7152463 tgtttttggtacgggaggaagagaactttactgat 7152429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University