View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_low_38 (Length: 340)
Name: NF1245_low_38
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 244 - 329
Target Start/End: Complemental strand, 7152365 - 7152280
Alignment:
| Q |
244 |
agacctggtgattctcaagtggatgccgttttgatccaatggtcgaatttgttagcttctaccaatgctttcccatattccttcat |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7152365 |
agacctggtgattctcaagtggatgccgttttgatccaatggtcgaatttgttagcttctaccaatgctttcccagattccttcat |
7152280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 64
Target Start/End: Complemental strand, 7152463 - 7152429
Alignment:
| Q |
30 |
tgtttttggtacgggaggaagagaactttactgat |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7152463 |
tgtttttggtacgggaggaagagaactttactgat |
7152429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University