View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_low_42 (Length: 333)
Name: NF1245_low_42
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 3242207 - 3242102
Alignment:
| Q |
1 |
atatgttttcgtatcagatattataaaatcaaaattgccataaaaaacagttggatatatacaccaacaatatagaagatagtacctaaggctatggcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3242207 |
atatgttttcgtatcagatattataaaatcaaaattgccataaaaaacagttggatatatacatcaacaatatagaagatagtacctaaggctatggcaa |
3242108 |
T |
 |
| Q |
101 |
ttcttc |
106 |
Q |
| |
|
|||||| |
|
|
| T |
3242107 |
ttcttc |
3242102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 170 - 198
Target Start/End: Complemental strand, 3242038 - 3242010
Alignment:
| Q |
170 |
gaaaacaatgcataaacatgtgttcaaga |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3242038 |
gaaaacaatgcataaacatgtgttcaaga |
3242010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University