View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_low_46 (Length: 331)
Name: NF1245_low_46
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_low_46 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 30 - 331
Target Start/End: Complemental strand, 35341040 - 35340739
Alignment:
| Q |
30 |
ggagtctcttgacttgcatgcaatgaatctctcaggctcattgtcttccagcattggtggtttggttcacttgcttcaccttaatctgtctcaaaacact |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35341040 |
ggagtctcttgacttgcatgcaatgaatctctcaggctcattgtcttccagcattggtggtttggttcacttgcttcaccttaatctgtctcaaaacact |
35340941 |
T |
|
| Q |
130 |
ttctctggttttataccaaaggaaattggaaactgttcaagtttgcaagttcttggcctcaacatcaatgaatttgaaggtcaaattcctgtagaaatag |
229 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35340940 |
ttctctggttctataccaaaggaaattggaaactgttcaagtttgcaagttcttggcctcaacatcaatgaatttgaaggtcaaattcctgtagaaatag |
35340841 |
T |
|
| Q |
230 |
gccggctttcgaatttaaccgagttgcatctttcaaacaaccagctctctggacctttaccagatgcaattggtaacctttcttcactctcaatagttac |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35340840 |
gccggctttcgaatttaaccgagttgcatctttcaaacaaccagctctctggacctttaccagatgcaattggtaacctttcttcactctcaatagttac |
35340741 |
T |
|
| Q |
330 |
tc |
331 |
Q |
| |
|
|| |
|
|
| T |
35340740 |
tc |
35340739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University