View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_low_50 (Length: 311)
Name: NF1245_low_50
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_low_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 30400683 - 30400896
Alignment:
| Q |
1 |
taatctgttgttacattctcgtctctatacaattcatatacttttaattattgagaataaatcttggatttaggtaagaagaccgttagttcagccaacg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30400683 |
taatctgttgttacattcttgtctctatacaattcatatacttttaattattgagaataaatcttggatttaggtaagaagaccgttagttcagccaacg |
30400782 |
T |
|
| Q |
101 |
caaaaaagttaccttatttcacaagaatgtacttaggnnnnnnntgtagttcatttatatgattgcaataatgttactaaatctgtaatttcttttcttc |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30400783 |
caaaaaagttaccttatttcacgagaatgtacttaggaaaaaaatgtagttcatttatatgattgcaataatgttactaaatctgtaatttcttttcttc |
30400882 |
T |
|
| Q |
201 |
tacagtctccgact |
214 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
30400883 |
tatagtctccgact |
30400896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University