View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_low_51 (Length: 310)
Name: NF1245_low_51
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 30400707 - 30400487
Alignment:
| Q |
1 |
gagacgagaatgtaacaacagattaccccctcaaaaatttaaaacaaatttccataccaagtagcaaaatttattcacaaacatacagaagattggtcat |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30400707 |
gagacaagaatgtaacaacagattaccccctcaaaaatttaaaacaaatttccataccaagtagcaaaatttattcacaaacatacacaagattggtcat |
30400608 |
T |
 |
| Q |
101 |
taattaagaaatgaaaatgtgaataacagtgttatttattaccgttatatgaatgactcttcctctcagttttgacccttgagctaatgcagccacccat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30400607 |
taattaagaaatgaaaatgtgaataacagtgttatttattaccgttatatgaatgactcttcctctcagttttgacccttgagctaatgcagccatccat |
30400508 |
T |
 |
| Q |
201 |
gccagtgtgttattgatgatg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30400507 |
gccagtgtgttattgatgatg |
30400487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 139
Target Start/End: Complemental strand, 30388344 - 30388308
Alignment:
| Q |
103 |
attaagaaatgaaaatgtgaataacagtgttatttat |
139 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
30388344 |
attaagaaaggaaaatgtgaataacaatgttatttat |
30388308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University