View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_low_52 (Length: 308)
Name: NF1245_low_52
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_low_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 102 - 271
Target Start/End: Complemental strand, 26233643 - 26233474
Alignment:
| Q |
102 |
atataggtgtgtatgtgacacataaggaatacaattatgaaacgtaagagataagagattggggaagtttggtgggaaatctctattctttagggatcag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26233643 |
atataggtgtgtatgtgacacataaggaatacaattatgaaacgtaagagataagagattggagaagtttggtgggaaagctctattctttagggatcag |
26233544 |
T |
|
| Q |
202 |
tttgaaggggactaaattggaccatgtcgttgacagagaaagaaggttctatattatttgtatgactcat |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26233543 |
tttgaaggggactaaattggaccatgtcgttgacagagagagaaggttctatattatttgtatgactcat |
26233474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University