View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_low_58 (Length: 299)
Name: NF1245_low_58
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 12 - 270
Target Start/End: Complemental strand, 37865537 - 37865278
Alignment:
| Q |
12 |
agagaaagaaacacatgaccgtaaagagtgagattggggcggtgggaaggacagtgagtgagtgagtatctccaaatgttcccacgctacgctaccctgc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
37865537 |
agagaaagaaacacatgaccgtaaagagtgagattggggcggtgggaaggacagtgagtgagtgagtatcttcaaacgttcccacgctacgctaccctgc |
37865438 |
T |
 |
| Q |
112 |
cgtctcagtctcactaacttaattcacttccacttttttcttcttattctcaataagctattactattactcaataagcgattataaatactacaaatga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37865437 |
cgtctcagtctcactaacttaattcacttccacttttttcttcttattctcaataagctattactattactcaataagcgattataaatactacaaatga |
37865338 |
T |
 |
| Q |
212 |
atgcacttacattataacttacttttacct-aaaactgaaaaccagtttagtgaagtatg |
270 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
37865337 |
atgcacttacattataacttatttttacctgaaaactcaaaaccagtttagtgaagtatg |
37865278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University