View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_low_87 (Length: 250)
Name: NF1245_low_87
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_low_87 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 45316202 - 45316434
Alignment:
| Q |
18 |
gaggtgtcaatgttgcacttgttgtacctaccaaccccagttttgtccatctgacagtgcctgcagcattgttaatcgtgtgacgggtctgcccgctatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45316202 |
gaggtgtcaatgttgcacttgttgtacctaccaacctcagttttgtccatctgacagtgcctgcagcattgttaatcgtgtgacgggtctgcctgctatg |
45316301 |
T |
|
| Q |
118 |
ttgagcatttctccaaccttcaagaaaattcatttctcaatcacacaccaaccttgtgctctccgccgtattactccacaccttgttgctccgttgtttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45316302 |
ttgagcatttctccaaccttcaagaaaattcctttctcaatcacacaccaaccttgtgctctccgccgtattactccacaccttgttgctccgttgtttc |
45316401 |
T |
|
| Q |
218 |
ctaacaatccataacaaactgcacataatatta |
250 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||| |
|
|
| T |
45316402 |
ctaacactccataacaaactgcaaataatatta |
45316434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University