View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1245_low_94 (Length: 223)

Name: NF1245_low_94
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1245_low_94
NF1245_low_94
[»] chr8 (1 HSPs)
chr8 (113-200)||(39793431-39793518)


Alignment Details
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 113 - 200
Target Start/End: Original strand, 39793431 - 39793518
Alignment:
113 ctctccctgcaacaggtttgtttctacttcccnnnnnnnggggactgagcaaaacaaaagataccatcatacgaagtggtaggttgcc 200  Q
    ||||||||||||||||||||||||||||| ||        ||||||||||| ||| ||||||||||||||||||||||||||||||||    
39793431 ctctccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgcc 39793518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University