View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1245_low_96 (Length: 207)
Name: NF1245_low_96
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1245_low_96 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 42463948 - 42463841
Alignment:
| Q |
1 |
acaaaaccttcatttttgtagccaccgaggttgcttgcataagcacgagaaagatgtcgattgagggacgcagaattgaattgagtaagaacatagatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463948 |
acaaaaccttcatttttgtagccaccgaggttgcttgcataagcacgagaaagatgtcgattgagggacgcagaattgaattgagtaagaacatagatct |
42463849 |
T |
|
| Q |
101 |
tcgatatg |
108 |
Q |
| |
|
| |||||| |
|
|
| T |
42463848 |
tagatatg |
42463841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University