View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1245_low_98 (Length: 203)

Name: NF1245_low_98
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1245_low_98
NF1245_low_98
[»] chr7 (1 HSPs)
chr7 (1-42)||(27154610-27154651)


Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 27154651 - 27154610
Alignment:
1 cattgtttctatggtgtagcaaggatatagtaggcacctaat 42  Q
    ||||||||||||||||||||||||||||||||||||||||||    
27154651 cattgtttctatggtgtagcaaggatatagtaggcacctaat 27154610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University