View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12460_high_2 (Length: 340)
Name: NF12460_high_2
Description: NF12460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12460_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 3 - 311
Target Start/End: Original strand, 4142448 - 4142760
Alignment:
| Q |
3 |
tggaggaatgggagctggtgggaatggaatgagaggtggagcaaggtcctttggtggtatgtttggtggtgatgctcatatgttttcttcatttgatgaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4142448 |
tggaggaatgggagctggtgggaatggaatgagaggtggagcaaggtcctttggtggaatgtttggtggtgatgatcatatgttttcttcatttgatgaa |
4142547 |
T |
|
| Q |
103 |
ggtaggcctatgcgtcagcagggtcctcgcaaggcagctgctattgaaaatagattgccttgtagtcttgaggaactctataaagggactaccaaaaaga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4142548 |
ggtaggcctatgcgtcagcagggtcctcgcaaggcagctgctattgaaaatagattgccttgtagtcttgaggaactctataaagggactaccaaaaaga |
4142647 |
T |
|
| Q |
203 |
tgaagatttcaagggaaattgcagatgcaagtgggtatgtattctttgcataaaatttcattccattc----tattgttagagtttaaccttttagcaat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
4142648 |
tgaagatttcaagggaaattgcagatgcaagtgggtatgtattatttgcataaaatttcattccattctatttattgttagagtctaaccttttagcaat |
4142747 |
T |
|
| Q |
299 |
taacaatgttatt |
311 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4142748 |
taacaatgttatt |
4142760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 130 - 239
Target Start/End: Original strand, 4146834 - 4146943
Alignment:
| Q |
130 |
cgcaaggcagctgctattgaaaatagattgccttgtagtcttgaggaactctataaagggactaccaaaaagatgaagatttcaagggaaattgcagatg |
229 |
Q |
| |
|
||||||||| || | |||||||||| ||||||||| || ||||||||||| |||||||| |||||||||||||||||||| ||||||||||||||| | | |
|
|
| T |
4146834 |
cgcaaggcacctcccattgaaaataaattgccttgcagccttgaggaactttataaaggcactaccaaaaagatgaagatctcaagggaaattgcatacg |
4146933 |
T |
|
| Q |
230 |
caagtgggta |
239 |
Q |
| |
|
|||| ||||| |
|
|
| T |
4146934 |
caagcgggta |
4146943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University