View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12460_low_3 (Length: 292)
Name: NF12460_low_3
Description: NF12460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12460_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 21 - 276
Target Start/End: Complemental strand, 8615461 - 8615206
Alignment:
| Q |
21 |
tcttaactggtcttcttccattgattgttgcagttgggaaggtataacttgtgatcaaaataatcaccatgttacacatcttttcttaccttctagagga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8615461 |
tcttaactggtcttcttccattgattgttgcagttgggaaggtataacttgtgatcaaaataatcaccatgttacacatcttttcttaccttctagagga |
8615362 |
T |
 |
| Q |
121 |
ctcactggtttcatttcattttctcttttaacttcccttgaatctctttctcatcttaatctttcacataatagattttatggtaatcttcaaaatcact |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8615361 |
ctcactggtttcatttcattttctcttttaacttcccttgaatctctttctcatcttaatctttcacataatagattttatggtaatcttcaaaatcact |
8615262 |
T |
 |
| Q |
221 |
tttttgatcttcttaatcatcttttagtccttgatttgagttataatcacttctct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8615261 |
tttttgatcttcttaatcatcttttagtccttgatttgagttataatcacttctct |
8615206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University