View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12461_high_18 (Length: 206)
Name: NF12461_high_18
Description: NF12461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12461_high_18 |
 | |
|
| [»] scaffold0224 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0224 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: scaffold0224
Description:
Target: scaffold0224; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 16 - 99
Target Start/End: Complemental strand, 13850 - 13767
Alignment:
| Q |
16 |
catatcatacttaagtcatagttttattgctgcactaactacattcacacatgccataacagatgaaccatcttcatcctcaca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
13850 |
catatcatacttaagtcatagttttattgctgcactaacttcattcacacatgccataacagatgaaccaccttcatcttcaca |
13767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 16 - 99
Target Start/End: Original strand, 42932921 - 42933004
Alignment:
| Q |
16 |
catatcatacttaagtcatagttttattgctgcactaactacattcacacatgccataacagatgaaccatcttcatcctcaca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
42932921 |
catatcatacttaagtcatagttttattgctgcactaacttcattcacacatgccataacagatgaaccaccttcatcttcaca |
42933004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University