View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12461_high_6 (Length: 338)
Name: NF12461_high_6
Description: NF12461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12461_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 29369277 - 29368952
Alignment:
| Q |
1 |
cgcacaggttgaagcgggtgaaatatatttcttcaccaactcacaagaaagaccaggatcacagcccaacaggcaacccacaagttgttcaacaagtgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29369277 |
cgcacaggttgaagcgggtgaaatatatttcttcaccaactcacaagaaagaccaggatcacagcccaacaggcaacccacaagttgttcaacaagtgag |
29369178 |
T |
 |
| Q |
101 |
acatttacatttatagcagccaaagttgaattttgtacatcattagtttcactagcaagtatgtaaagggttcgggcaacaagagaagcagcagcagcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29369177 |
acatttacatttatagcagccaaagttgaattttgtacatcattagtttcactagcaagtatgtaaagggttcgggcaacaagagaagcagcagcaacta |
29369078 |
T |
 |
| Q |
201 |
cagccgatgagttcacatttgctgcatttaatcatacaaatgagacggcatatgacaagggaaatagccatgaaagactagaaaaagtcaaacaggtaag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29369077 |
cagccgatgagttcacatttgctgcatttaatcatacaaatgagacggcatataacaaggg-aatagccatgaaaggctagaaaaagtcaaacaggtaag |
29368979 |
T |
 |
| Q |
301 |
nnnnnnntaatgccagggtcacaggtt |
327 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29368978 |
aagaaaataatgccagggtcacaggtt |
29368952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University