View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12461_high_9 (Length: 318)
Name: NF12461_high_9
Description: NF12461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12461_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 6 - 244
Target Start/End: Complemental strand, 48342512 - 48342274
Alignment:
| Q |
6 |
agtttgaaatcttgatgaacatgatctcttacccccaaatagtttgggctcatgtttctctcttttcttggtttgtaattttgatatgcattttttattt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48342512 |
agtttgaaatcttgatgaacatgatctcttacccccaaatagtttgggctcatgtttctctcttttcttggtttgtaattttgatatgcattttttattt |
48342413 |
T |
 |
| Q |
106 |
actgcaacatgatctgttatgatatgctcattctcctcatgccaatcatcttcgtttgaaaggtaatctaaagaaagaattacaagcaacatgtttaggt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48342412 |
actgcaacatgatctgttatgatatgctcattctcctcatgccaatcatcttcgtttgaaaggtaatctaaagaaagaattacaagcaacatgtttaggt |
48342313 |
T |
 |
| Q |
206 |
caacaagagatgtgtttgacatatgtgaatgagacaatg |
244 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48342312 |
caacaagagatgtgtttgacacatgtgaatgagacaatg |
48342274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 80
Target Start/End: Complemental strand, 2242138 - 2242067
Alignment:
| Q |
8 |
tttgaaatcttgatgaacatgatctcttacccccaaatagtttgggctcatgtttctctcttttcttggtttg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2242138 |
tttgaaatcttgatgaacatgatctctttcccc-aaatagtttgggctcatgttgatctcttttcttggtttg |
2242067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University