View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12461_low_12 (Length: 299)
Name: NF12461_low_12
Description: NF12461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12461_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 15 - 284
Target Start/End: Original strand, 9993586 - 9993855
Alignment:
| Q |
15 |
gtgctctttatgttgtgctatttgttacatcaaatatttggaaatggagaatagagattggctaaaccaagccaatcaaatcaatgtttttgttgagaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9993586 |
gtgctctttatgttgtgctatttgttacatcaaatatttggaaatggagaatagagattggctaaaccaagccaatcaaatcaatgtttttgttgagaat |
9993685 |
T |
 |
| Q |
115 |
ctacaagattgaaagttctaaacgattgggcaactattgttgttgtccaaatgcaaaataatggaagttgcctttcatgatgataattaaacccaatcct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9993686 |
ctacaagattgaaagttctaaacgattgggcaactattgttgttgtccaaatgcaaaataatggaagttgcctttcatgatgataattaaacccaatcct |
9993785 |
T |
 |
| Q |
215 |
tatgtgtaggctctttttgtcgtcaacattttgtttattcctttaatgtgagagccccatttaccataac |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9993786 |
tatgtgtaggctctttttgtcgtcaacattttgtttattcctttaatgtgagagccccatttaccataac |
9993855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University