View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12461_low_13 (Length: 289)
Name: NF12461_low_13
Description: NF12461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12461_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 279
Target Start/End: Complemental strand, 32243697 - 32243436
Alignment:
| Q |
18 |
tgaaaacttctccagatgccataatttccaatgtgtcatgcacctcgccatcatgatttccaacataagaaaccacgagcttctgctttgtagccactag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32243697 |
tgaaaacttctccagatgccataatttccaatgtgtcatgcacctcgccatcatgatttccaacataagaaaccacgagcttctgctttgtagccactag |
32243598 |
T |
 |
| Q |
118 |
tctaatgtacccaaattcacccccacgatacaaagaccgttttggttgtggaaagatcgagtcattgggatgacccggtcttgttttccagatggattgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32243597 |
tctaatgtacccaaattcacccccacgatacaaagaccgttttggttgtggaaagatcgagtcattgggatgacccggtcttgttttccagatggattgc |
32243498 |
T |
 |
| Q |
218 |
ttgtcttgccctgccatgccaatcacaagatgaacggtatatcctctgtctcctgctctctg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
32243497 |
ttgtcttgccctgccatgccaatcacaagatgaacggtatatcctttgtctcttgctctctg |
32243436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 22 - 257
Target Start/End: Complemental strand, 32248774 - 32248539
Alignment:
| Q |
22 |
aacttctccagatgccataatttccaatgtgtcatgcacctcgccatcatgatttccaacataagaaaccacgagcttctgctttgtagccactagtcta |
121 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||| | |||| |
|
|
| T |
32248774 |
aacttctccagattccagaatctccaatgtgtcatgcacctcgccatcatgattaccaacataagaaatcacgagattctgctttgtagccatcaatcta |
32248675 |
T |
 |
| Q |
122 |
atgtacccaaattcacccccacgatacaaagaccgttttggttgtggaaagatcgagtcattgggatgacccggtcttgttttccagatggattgcttgt |
221 |
Q |
| |
|
||||| || || |||||||| || |||||||| ||||||||||||||| |||| | | ||| ||||||| ||||||||| | ||| |||| |||| || |
|
|
| T |
32248674 |
atgtatccgaactcacccccgcggtacaaagatcgttttggttgtggatagattgggacatcgggatgatccggtcttggtcgccacatgggttgccagt |
32248575 |
T |
 |
| Q |
222 |
cttgccctgccatgccaatcacaagatgaacggtat |
257 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
32248574 |
cttgccctgccatgccgatcacaagatgaatggtat |
32248539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University