View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12462_high_1 (Length: 298)
Name: NF12462_high_1
Description: NF12462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12462_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 2836203 - 2836031
Alignment:
| Q |
18 |
tgatccacaaccagtcaagaacagccccagcaaatatacccgtcaaaagacaaaggacaagaacatttcccaaagcattctgctcaggaccctgcaacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2836203 |
tgatccacaaccagtcaagaacagccccagtaaatatacccgtcaaaagacaaaggacaagaacatttcccaaagcattctgctcaggaccctgcaacaa |
2836104 |
T |
|
| Q |
118 |
tacaaactccaaaattagtacagaacttagaaccaatgcaacattcacacatatcgttaaattcaattacttc |
190 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2836103 |
tacaaactccgaaattagtacagaacttagaaccaatgcaacattcacacatatcgttaaattcaatcacttc |
2836031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 225 - 282
Target Start/End: Complemental strand, 2835974 - 2835917
Alignment:
| Q |
225 |
gtgatagtgtctgctttcgtgtttcatgggtttatatcaacattttatgagttgtgga |
282 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2835974 |
gtgatagtgtctgctttcgtgtttcataggtttatatcaacattttatgagttgtgga |
2835917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University