View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12462_low_1 (Length: 298)

Name: NF12462_low_1
Description: NF12462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12462_low_1
NF12462_low_1
[»] chr2 (2 HSPs)
chr2 (18-190)||(2836031-2836203)
chr2 (225-282)||(2835917-2835974)


Alignment Details
Target: chr2 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 2836203 - 2836031
Alignment:
18 tgatccacaaccagtcaagaacagccccagcaaatatacccgtcaaaagacaaaggacaagaacatttcccaaagcattctgctcaggaccctgcaacaa 117  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2836203 tgatccacaaccagtcaagaacagccccagtaaatatacccgtcaaaagacaaaggacaagaacatttcccaaagcattctgctcaggaccctgcaacaa 2836104  T
118 tacaaactccaaaattagtacagaacttagaaccaatgcaacattcacacatatcgttaaattcaattacttc 190  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
2836103 tacaaactccgaaattagtacagaacttagaaccaatgcaacattcacacatatcgttaaattcaatcacttc 2836031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 225 - 282
Target Start/End: Complemental strand, 2835974 - 2835917
Alignment:
225 gtgatagtgtctgctttcgtgtttcatgggtttatatcaacattttatgagttgtgga 282  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
2835974 gtgatagtgtctgctttcgtgtttcataggtttatatcaacattttatgagttgtgga 2835917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University