View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12463_high_5 (Length: 349)

Name: NF12463_high_5
Description: NF12463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12463_high_5
NF12463_high_5
[»] chr2 (1 HSPs)
chr2 (229-332)||(13714013-13714116)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 229 - 332
Target Start/End: Original strand, 13714013 - 13714116
Alignment:
229 atgggaatagctcctcttttagtggctgcttcaaaattctcttttctaacaactccaatatgacccctttccacttgaataggtgagacacataatgtac 328  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13714013 atggaaatagctcctcttttagtggctgcttcaaaattctcttttctaacaactccaatatgacccctttccacttgaataggtgagacacataatgtac 13714112  T
329 taaa 332  Q
    ||||    
13714113 taaa 13714116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University