View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12463_high_5 (Length: 349)
Name: NF12463_high_5
Description: NF12463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12463_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 229 - 332
Target Start/End: Original strand, 13714013 - 13714116
Alignment:
| Q |
229 |
atgggaatagctcctcttttagtggctgcttcaaaattctcttttctaacaactccaatatgacccctttccacttgaataggtgagacacataatgtac |
328 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13714013 |
atggaaatagctcctcttttagtggctgcttcaaaattctcttttctaacaactccaatatgacccctttccacttgaataggtgagacacataatgtac |
13714112 |
T |
|
| Q |
329 |
taaa |
332 |
Q |
| |
|
|||| |
|
|
| T |
13714113 |
taaa |
13714116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University