View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12463_low_8 (Length: 237)
Name: NF12463_low_8
Description: NF12463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12463_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 26312960 - 26313181
Alignment:
| Q |
1 |
gtttgtgccaccaacatgtctgctgataatctatccaattaccctccacatagccatcttgtttaacaaaaagaccttgagttaacacataaactgatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26312960 |
gtttgtgccaccaacatgtctgctgataatctatccaactaccctccacatagccatcttgttttacaaaaagaccttgagttaacacataaaccgatga |
26313059 |
T |
 |
| Q |
101 |
acaatgaaaacgttgactctgagattttcactgacatcttgaagagccnnnnnnnnnnnnncaaactgattttcacatgtttctttttgttgtggttttt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26313060 |
acaatgaaaacg-tgactctgagattttcactaacatcttgaagagccaaaaaaagaaaaacaaactgattttcacatgtttctttttgttgtggtttta |
26313158 |
T |
 |
| Q |
201 |
actttgaaaattattgttggttt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26313159 |
actttgaaaattattgttggttt |
26313181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 79
Target Start/End: Original strand, 1334025 - 1334084
Alignment:
| Q |
20 |
ctgctgataatctatccaattaccctccacatagccatcttgtttaacaaaaagaccttg |
79 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
1334025 |
ctgctcataatctatccaactaccctccacatagttgtcatgttttacaaaaagaccttg |
1334084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 132
Target Start/End: Original strand, 1334357 - 1334389
Alignment:
| Q |
100 |
aacaatgaaaacgttgactctgagattttcact |
132 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
1334357 |
aacaatgaaaatgttgactctgagattttcact |
1334389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University