View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12464_low_4 (Length: 280)
Name: NF12464_low_4
Description: NF12464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12464_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 10557272 - 10557009
Alignment:
| Q |
1 |
tccttctcttatgtatctagttgctggatcaaaacctggtagagctccttcattgtaccttctctttgcttcttttctacactctagtgcatactttata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557272 |
tccttctcttatgtatctagttgctggatcaaaacctggtagagctccttcattgtaccttctctttgcttcttttctacactctagtgcatactttata |
10557173 |
T |
 |
| Q |
101 |
tggtttctgaactcacgttgcaaatcagcaacaaatttcaaagcatctttggttagaatttttgcaaactctgcatcatatcttcccctaacttcgacac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10557172 |
tggtttctgaactcacgttgcaaatcagcaacaaatttcaaagcatctttggttagaatttttgcaaactctgcatcatatcttcccctaacttcgacgc |
10557073 |
T |
 |
| Q |
201 |
cttctggtgcgtcgtagttagagatgatattcttggctgttggtgtcggaaagccataggttcc |
264 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557072 |
cttctggtgcatcgtagttagagatgatattcttggctgttggtgtcggaaagccataggttcc |
10557009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University