View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12465_low_1 (Length: 245)
Name: NF12465_low_1
Description: NF12465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12465_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 121 - 189
Target Start/End: Complemental strand, 229925 - 229857
Alignment:
| Q |
121 |
gccaagcttaagagtaaagcccctgcattggcacctgtgctctcgccatcagatgctcccgctcccgga |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229925 |
gccaagcttaagagtaaagcccctgcattggcacctgtgctctcgccatcagatgctcccgctcccgga |
229857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University