View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12466_low_2 (Length: 306)
Name: NF12466_low_2
Description: NF12466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12466_low_2 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 74 - 306
Target Start/End: Original strand, 4188313 - 4188545
Alignment:
| Q |
74 |
ccacttcttctaaatcaaccatagtgatgtgtcggaaatgggatatttgcagtcaaatgtgttcattaagcttataatatctgagttaacataacattgt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4188313 |
ccacttcttctaaatcaaccatagtgatgtgtcggaaatgggatatttgcattcaaatgtgttcattaagcttataatatctgagttaacataacattgt |
4188412 |
T |
 |
| Q |
174 |
aagacatagagagaccatgtgcatgtcactttctatttggttgatttggtgcaataaaagacccaccgatgtcatctttatattcttccaccacaagtcg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4188413 |
aagacatagagagaccatgtgcatgtcactttctatttggttgatttggtgcaataaaagacccaccgatgtcatctttgtattcttccaccacaagtcg |
4188512 |
T |
 |
| Q |
274 |
ttcggtttctcctttaacctttgcttctccact |
306 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| |
|
|
| T |
4188513 |
ttcggtttctcctttaaccttttcttctacact |
4188545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University