View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12466_low_8 (Length: 228)
Name: NF12466_low_8
Description: NF12466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12466_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 12 - 210
Target Start/End: Complemental strand, 32179954 - 32179756
Alignment:
| Q |
12 |
aacctgtggtggaagtggtggtggaggaaaattccggtcatctgattcaacagattccgattcagaaacaaaatccgaacaacgtgagattctacaatcc |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32179954 |
aaccggtggtggaagtggtggtggaggaaaattccggtcatctgattcaacagattccgattcagaaacaaaatccgaacaacgtgagattctacaatcc |
32179855 |
T |
|
| Q |
112 |
atcgtccctctctttccgtcggagaaagctgcttttccgatcaacttcctctgctgccttctccggtgtgctatctacctacgcgcctctagcgcgtgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
32179854 |
atcgtccctctctttccgtcggagaaagctgcttttccgatcaacttcctctgctgtcttctccgttgtgctatctacctacgcgcctcaagcgcgtgc |
32179756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 120 - 200
Target Start/End: Complemental strand, 28250265 - 28250185
Alignment:
| Q |
120 |
tctctttccgtcggagaaagctgcttttccgatcaacttcctctgctgccttctccggtgtgctatctacctacgcgcctc |
200 |
Q |
| |
|
|||||| || ||||||||||| |||||||| ||||||||||| |||||||| ||||| || || ||| |||| |||||||| |
|
|
| T |
28250265 |
tctcttcccttcggagaaagcagcttttccaatcaacttcctttgctgcctcctccgttgcgccatccacctccgcgcctc |
28250185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University