View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12467_high_5 (Length: 329)
Name: NF12467_high_5
Description: NF12467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12467_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 184 - 319
Target Start/End: Original strand, 1993146 - 1993281
Alignment:
| Q |
184 |
ttcaatattaatattaatatatgctagcacatggcaattagcaatttgtcataatggtgaaagggaagtaagtacattcttcgaccttttcagaatatgn |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1993146 |
ttcaatattaatattaatatatgctagcacatggcaattagcaatttgtcataatggtgaaagggaagtaagtacattcttcgaccttttcagaatatgt |
1993245 |
T |
|
| Q |
284 |
nnnnnnnggtaactttttcagaacatgtgatctgtg |
319 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
1993246 |
tttttttggtaactttttcagaacatgtgatgtgtg |
1993281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 1992961 - 1993015
Alignment:
| Q |
1 |
gtttcacatagttgatagcttcttcaagtatgtaggccttatcggtctacatgta |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1992961 |
gtttcacatagttgatagcttcttcaagtatgtaggccttatcggtctacatgta |
1993015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 1985434 - 1985474
Alignment:
| Q |
1 |
gtttcacatagttgatagcttcttcaagtatgtaggcctta |
41 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
1985434 |
gtttcacataattgatagcttcttgaagtatgtagacctta |
1985474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University