View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12468_low_8 (Length: 292)
Name: NF12468_low_8
Description: NF12468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12468_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 279
Target Start/End: Original strand, 27985647 - 27985909
Alignment:
| Q |
11 |
acctgtgcatgctcgctcgtcaaaataggaccaagatatgtaaaatcttgtctctgggttggaaatggtaggtgaatttgagaagatggtggaggtggca |
110 |
Q |
| |
|
|||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27985647 |
acctgtgcatgctcccttgtcaaaataggacc--gatatgtaaaatcttgtctctgggttggaaatggtaggtgaatttgagaagatggtggaggtggca |
27985744 |
T |
|
| Q |
111 |
tggaatttggttgagtggaattaaaaatatgatcaagatatgtaaaatgtagcattttttattcttgatgcatgagtcacgtctgcattcacttgcttca |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27985745 |
tggaatttggttgactggaattaaaaatatgatcaagatatgtaaaatgtagcattttttattcttg----atgagtcacgtctgcattcacttgcttca |
27985840 |
T |
|
| Q |
211 |
gatttgggactggggtaccaacaagcattaaataaactagttggttgtgcaatatcaaagaaggtggtg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27985841 |
gatttgggactggggtaccaacaagcattaaataaactagttggttgtgcaatatcaaagaaggtggtg |
27985909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 14 - 84
Target Start/End: Complemental strand, 10506826 - 10506756
Alignment:
| Q |
14 |
tgtgcatgctcgctcgtcaaaataggaccaagatatgtaaaatcttgtctctgggttggaaatggtaggtg |
84 |
Q |
| |
|
|||||||| || ||| ||||| |||||||||||||||||||||| || | || |||||||||||| |||| |
|
|
| T |
10506826 |
tgtgcatgttccctcctcaaagtaggaccaagatatgtaaaatcaggtttatgtgttggaaatggtgggtg |
10506756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University