View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12469_low_5 (Length: 288)
Name: NF12469_low_5
Description: NF12469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12469_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 6729691 - 6729976
Alignment:
| Q |
1 |
gagatagtactctgcatgctgcatatatgtttggtacgttttcagaaagttgttaaagtaaattacttttgtacgtattcttacaaaggttctatccaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6729691 |
gagatagtactctgcatgctgcatatatgtttggtacgttttcagaaagttgttaaagtaaattacttttgtacgtattcttacaaaggttctatccaca |
6729790 |
T |
|
| Q |
101 |
tacat--atatataattaaatctgacttatatgtactatgatgctgtcatatactgaggaataaagcttattatatagagagatataagaattcatttgt |
198 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6729791 |
tacatttatatataattaaatctgacttatatgtactatgatgctgtcatatactgaggaataaagcttattatatagagagatataagaattcatttgt |
6729890 |
T |
|
| Q |
199 |
gagtgcatggcatgcagatgcagatttatatgtgcagtgtatatgtattatgtactcactctttcattgactccttcttctctctc |
284 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6729891 |
gtgtgcatggcatgcagatgcagatttatatgtgcagtgtatatgtattatgtaatcactctttcattgactccttcttctctctc |
6729976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University