View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_high_14 (Length: 433)
Name: NF1246_high_14
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 93 - 425
Target Start/End: Complemental strand, 37278886 - 37278555
Alignment:
| Q |
93 |
ctcggttgattagtgataatgttaaaggagtctctactcctcgtttaatttcttgttagnnnnnnnnnnnnggacataggcccttctgtatccctaaaaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| | |||||||||||| |
|
|
| T |
37278886 |
ctcggttgattagtgataatgttaaaggagtctctactcctcgtttaatttcttgttagtttttcttttttggacattggcccttttatatccctaaaaa |
37278787 |
T |
|
| Q |
193 |
atatcctcatgacccttaaaattttgacgacgtaattcatgtctctttgcaaaatgaatttgtaaacatgccaatttcacaagaatatcnnnnnnnnnnn |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37278786 |
atatcctcatgacccttaaaattttgacgacgtaattcatgtctctt-gcaaaatgaatttgtaaacatgccaatttcacaagaatatcaaaaattgaaa |
37278688 |
T |
|
| Q |
293 |
nnnnnnnnctaaatttaattcaagaataaattgggaataactatatttgttattgagttttgcttatatttaaaacaaattattttgatgttatagcggt |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37278687 |
aaataaatctaaatttaattcaagaataaattgggaataactatatttgttattgagttttgcttatatttaaaacaaattattttgatgttatagccgt |
37278588 |
T |
|
| Q |
393 |
gcttggtaagaaaggcttgtgaccccctatgat |
425 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
37278587 |
gcttggtaagaaaggcttgtgaccctctatgat |
37278555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University