View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_high_18 (Length: 407)
Name: NF1246_high_18
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 66 - 392
Target Start/End: Complemental strand, 40965608 - 40965282
Alignment:
| Q |
66 |
tgacatgaagaataacaaggggctttattggagtatgtggaagagtacaaaactgagaagagaatttggttgtagagcgagaagtagaaggagcatagaa |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40965608 |
tgacatgaagaataacaaggggctttattggagtatgtggaagagtacaaaactgagaagagaatttggttgtagagcgagaagtagaaggaacatagaa |
40965509 |
T |
 |
| Q |
166 |
gcaattcatagacctagtaatggtgggaagtggcgatgatggatgaattcgccacggttgaacggttgaagatttaatcaaatccattcggtttttctca |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40965508 |
gcaattcatagacctagtaatggtgggaagtggcgatgatggaggaattcgccgcggttgaacggttgaagatttaatcaaatccattcggtttttctca |
40965409 |
T |
 |
| Q |
266 |
gaaaggacaaagtgtgatgtgatatgaaaatattactgatttatatttggagggaatacatatgggccaagctcgtcccatacatctaaagcaatgctat |
365 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40965408 |
gaaaggacaaagagtgatgtgatatgaaaatattactgatttatatttggagggaatacatatgggccaagctcgtcccatacatctaaagcaatgctat |
40965309 |
T |
 |
| Q |
366 |
catgaaagatggtttcttttttcacct |
392 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
40965308 |
catgaaagataatttcttttttcacct |
40965282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University