View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_high_20 (Length: 373)
Name: NF1246_high_20
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 94 - 364
Target Start/End: Original strand, 7088871 - 7089141
Alignment:
| Q |
94 |
agatatggggattaagtgcattgtactccgcattcgccttggccctctcgtacgaagaacattgagttcataagatacagttgctactttatagttagca |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7088871 |
agatatggggattaagtgcattgtactccgcattcgccttggacctctcgtacgaagaacattgagttcataagatacagttgctactttatagttagca |
7088970 |
T |
 |
| Q |
194 |
ggagcaggagcagcccttggaagtacttgcttcatatgaaccttttgttgcaacttgcaactcgatggaagcaaagacacatgtggaggatgaccatcta |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7088971 |
ggagcaggagcagcccttggaagtacttgcttcatatgaaccttttgttgcaacttgcaactcgatggaagcgaagacacatgtggaggatgaccatcta |
7089070 |
T |
 |
| Q |
294 |
agattgtgaacttggtgccgagaaaattagacctgttcattgcttaatgatcaagtaaacagtagaataat |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7089071 |
agattgtgaacttggtgccgagaaaattagacctgttcattgcttaatgatcaagtaaacagtagaataat |
7089141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 176 - 364
Target Start/End: Original strand, 7668293 - 7668484
Alignment:
| Q |
176 |
gctactttatagttagcaggagcaggagcagcccttggaagtacttgcttcatat--gaaccttttgttgcaacttgcaactcgatggaagcaaagacac |
273 |
Q |
| |
|
|||||||||||| |||||| |||||||||| |||| |||| |||||||||||||| | ||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
7668293 |
gctactttatagctagcagtagcaggagcaaccctaggaaatacttgcttcatatatggaccttttgttgcaacttgcaactcgatggaagcgaagaaac |
7668392 |
T |
 |
| Q |
274 |
atgtggaggatgaccatctaagattgtgaacttggtgccgagaaaattagacctgtt-cattgcttaatgatcaagtaaacagtagaataat |
364 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||| || ||||||||| |
|
|
| T |
7668393 |
atgtggaggatgaccatccaagatcgtgaacttggtgccgagaaaattagacctgttattttgcttaatgatcaactaagcactagaataat |
7668484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University