View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_high_34 (Length: 266)
Name: NF1246_high_34
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_high_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 30 - 254
Target Start/End: Original strand, 43061096 - 43061320
Alignment:
| Q |
30 |
ttatatcagttttattttccgctctttcctttggcatgcaagtgtttcggttcaatttacatattttattgtcagttttacctgactgtttgtatttgtc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43061096 |
ttatatcagttttattttccgctctttcctttggcatgcaagtgtttcagttcaatttacatattttattgtcagttttacctgactgtttgtatttgtc |
43061195 |
T |
 |
| Q |
130 |
tcctgctgttttctcagtataggtggctacaatttaatttggctctttagtgtagtttgttttggttcgttttcaagatggttaaataaacactttcaaa |
229 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43061196 |
tcctgctggtttctcagtataggtggctacaatttaatttggctctttagtgtagtttgttttggttcgttttcaagatggttaaataaacactttcaaa |
43061295 |
T |
 |
| Q |
230 |
caaatagttgaaacttgctgatatt |
254 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43061296 |
caaatagttgaaacttgctgatatt |
43061320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 233
Target Start/End: Original strand, 1380596 - 1380662
Alignment:
| Q |
167 |
tttggctctttagtgtagtttgttttggttcgttttcaagatggttaaataaacactttcaaacaaa |
233 |
Q |
| |
|
|||| |||||||| |||||| ||||| ||| | ||||||||| ||||||||||| | |||||||||| |
|
|
| T |
1380596 |
tttgtctctttagcgtagttggttttagtttgatttcaagatagttaaataaacgccttcaaacaaa |
1380662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 166 - 219
Target Start/End: Original strand, 40910936 - 40910989
Alignment:
| Q |
166 |
atttggctctttagtgtagtttgttttggttcgttttcaagatggttaaataaa |
219 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| ||||| |||| |||||||||| |
|
|
| T |
40910936 |
atttgtctctttagtgtagttggttttggtttgttttagagatagttaaataaa |
40910989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University