View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_high_54 (Length: 202)
Name: NF1246_high_54
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_high_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 14 - 188
Target Start/End: Original strand, 4158878 - 4159052
Alignment:
| Q |
14 |
caaaggttaacacggcaataccnnnnnnngttcatagagtgaaaaataaaggatgatcatgaattcacgactcaaaaggttttgcttatttatggattct |
113 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4158878 |
caaaggttaacacggcaataccaaaaaaagttcatagagtgaaaaataaaggatgatcatgaattcacgactcaaaaggttttgcttatttatggattct |
4158977 |
T |
 |
| Q |
114 |
gtccctttatgccttcttttttacttgctaactaggctttatttgtcaataaattcaaactgaaaggttatacat |
188 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4158978 |
gtccctatatgccttcttttttacttgctaactaggctttatttgtcaataaattcaaactgaaaggttatacat |
4159052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University