View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_100 (Length: 278)
Name: NF1246_low_100
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_100 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 57 - 239
Target Start/End: Original strand, 16016578 - 16016760
Alignment:
| Q |
57 |
ttattttcttacattaagattcgaagtttaaagcaaaagggtgacatgcaagatataaagattcgggagcttcnnnnnnntatcgaggaagccaatctat |
156 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16016578 |
ttattttcttacatgaagattcgaagtttaaagcaaaagggtgacatgcaagatataaagattcgggagcttcaaaaaaatatcgaggaagccaatctat |
16016677 |
T |
 |
| Q |
157 |
tggctggagaggaatcttctaagcatagagaagcaaaggaattcatcaagtctataacagaagaggtattttgtttctatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16016678 |
tggctggagaggaatcttctaagcatagagaagcaaaggaattcatcaagtctataacagaagaggtattttgtttctatatt |
16016760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University