View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1246_low_108 (Length: 264)

Name: NF1246_low_108
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1246_low_108
NF1246_low_108
[»] chr8 (1 HSPs)
chr8 (168-222)||(41380174-41380230)


Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 168 - 222
Target Start/End: Original strand, 41380174 - 41380230
Alignment:
168 gggatgtataagctggctgacctagttgttgagtc--gcgtgtgtttgtgtgtttct 222  Q
    ||||| |||||||||||||||||||||||||||||  ||||||||||||||||||||    
41380174 gggatatataagctggctgacctagttgttgagtcgtgcgtgtgtttgtgtgtttct 41380230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University