View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_110 (Length: 263)
Name: NF1246_low_110
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_110 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 9219000 - 9218796
Alignment:
| Q |
19 |
gtatcataggcatgttatacatttaagcatataacgnnnnnnnnnntttataccagtatttatgtgcatatgtatgtctaaaaaggacaaacaactctac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9219000 |
gtatcataggcatgttatacatttaagcatataacgaaaaaagaattttataccagtatttatgtgcatatgtatgtctaaaaaggacaaacaactctac |
9218901 |
T |
 |
| Q |
119 |
aagctgtacaatgtatatatatgcttctacacaactatctttgttactttctgtcaaaagcattaactaggttgatcagattcactataaccagatgctt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9218900 |
aagctgtacaatgtatatatatgcttctacacaactatctttgttactttctgtcaaaagcattaactaggttgatcagattcactataaccagacgctt |
9218801 |
T |
 |
| Q |
219 |
gtgcc |
223 |
Q |
| |
|
||||| |
|
|
| T |
9218800 |
gtgcc |
9218796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University