View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_111 (Length: 262)
Name: NF1246_low_111
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_111 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 28471791 - 28472021
Alignment:
| Q |
1 |
ttggataagctaattttgccacattatacctttctcaatcatctctcccacactttccttgtctaattaatgatatccatgttgtgatttagcatgtgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28471791 |
ttggataagctaattttgccacattatacccttctcaatcatctctcccacactttccttgtctaattaatgatatccatgttgtgatttagcatgtgtt |
28471890 |
T |
 |
| Q |
101 |
tattaatttacatctgaacacatgtttcaaacgttccaaatgtattttaggttcaataatttatttatttttaattatcaaggacttatgtatatggnnn |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28471891 |
tattaatttacatgtgaacacatgtttcaaacgttccaaatgtattttaggttcaataatttatttatttttaattatcaaggacttatgtatatggaaa |
28471990 |
T |
 |
| Q |
201 |
nnnnttatgtatatgaaaaagtaatatatat |
231 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28471991 |
aaaattatgtatatgaaaaagtaatatatat |
28472021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University