View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_124 (Length: 250)
Name: NF1246_low_124
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_124 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 23 - 140
Target Start/End: Original strand, 30319664 - 30319782
Alignment:
| Q |
23 |
atcataggcaccattggaaatgacccatttgcttcctaatcatnnnnnnncaatctttttcaatttttaacactacccac-nnnnnnnntcagctagatc |
121 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30319664 |
atcacaggcaccattggaaatgacccatttgcttcctaatcataaaaaaacaatccttttcaatttttaacactacccacaaaaaaaaatcagctagatc |
30319763 |
T |
|
| Q |
122 |
catgaattaaattcaaaag |
140 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30319764 |
catgaattaaattcaaaag |
30319782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University